Review



pet23a ubc9 addgene  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc pet23a ubc9 addgene
    Pet23a Ubc9 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pet28b+addgene/pET28b-hUba2-His+(Plasmid+%2353117)/10__1038_slash_s44318___025___00532___y-257-18-19
    Average 93 stars, based on 3 article reviews
    pet23a ubc9 addgene - by Bioz Stars, 2026-10
    93/100 stars

    Images

    Related Articles

    shRNA:

    Article Title: ARHGAP12 suppresses F-actin assembly to control epithelial tight junction mechanics and paracellular leak pathway permeability.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Osmium Tetroxide (2%) Electron Microscopy Sciences Cat# 19152 Potassium Ferricyanide Sigma-Aldrich Cat# 702587 Low Molecular Weight Tannic Acid Electron Microscopy Sciences Cat# 21700 Uranyl Acetate Electron Microscopy Sciences Cat# 22400 Lead Citrate Trihydrate Electron Microscopy Sciences Cat# 17800 Synthesized peptide NP1: RRQAPPPPPPSRGGP GenScript N/A Synthesized peptide NP1/2: RRQAPPPPPPSR GGPPPPPPPPHNSGPPPPPARGRGA GenScript N/A Synthesized peptide NP1/2/3: RRQAPPPPPPSRGGPPPPPPPPHN SGPPPPPARGRGAPPPPPSRAPTA GenScript N/A Synthesized peptide NP3/4/5: GRGAPPPPPSRAPTAAPPPPPP SRPSVAVPPPPPNRMYPPPPPALPSS GenScript N/A Synthesized peptide NP1 (R/A) mutant: RRQAPPPPPPSAGGP GenScript N/A Synthesized Mena peptide: GPPPPPPLPSTGPPP GenScript N/A Blebbistatin Sigma-Aldrich Cat# 203391 CK-666 MedChemExpress Cat# HY-16926 CK-869 MedChemExpress Cat# HY-16927 SMIFH2 MedChemExpress Cat# 340316-62-3 DMEM, high glucose Gibco Cat# 21068028 DMEM, high glucose, no glutamine, no calcium Gibco Cat# 21068028 Fluorescein sodium salt Sigma-Aldrich Cat# F6377 Fluorescein isothiocyanate–dextran (average mol wt 4,000) Sigma-Aldrich Cat# 46944 Fluorescein isothiocyanate–dextran (average mol wt 10,000) Sigma-Aldrich Cat# FD10S Fluorescein isothiocyanate–dextran (average mol wt 70,000) Sigma-Aldrich Cat# 46945 GFP-Trap Agarose Beads Chromotek Cat# gta-20 Paraformaldehyde Sigma-Aldrich Cat# 158127 PierceTM Protease Inhibitor Tablets, EDTA-free Thermo Fisher Scientific Cat# A32965 Polyethylenimine, Linear, MW 25000, Transfection Grade‘ Polysciences Cat# 23966-2 VECTASHIELD Antifade Mounting Medium Vector Laboratories Cat# H-1000-10 DAPI Sigma-Aldrich Cat# D9542 Phalloidin–Atto 565 Sigma-Aldrich Cat# 94072 Experimental models: Cell lines MDCK-II cells ATCC CCLV Cat# CCLV-RIE 1061; RRID: CVCL_0424 MDCK-II ARHGAP12 KO cells This study N/A MDCK-II ZO-1 KO cells Provided by Walter Hunziker N/A MDCK-II ZO-2 KO cells Provided by Walter Hunziker N/A HEK293T cells ATCC RRID: CVCL_0063 COS7 cells ATCC CLS Cat# 605470; RRID: CVCL_0224 Oligonucleotides ARHGAP12 gRNA For: CACCGTCTCATGCCGCCTGTTAAAC Integrated DNA Technologies, (IDT) N/A ARHGAP12 gRNA Rev: AAACGTTTAACAGGCGGCATGAGAC Integrated DNA Technologies, (IDT) N/A N-WASP shRNA For: /5Phos/GATCCCCGCAGCAGATC GTAACTGTATTCAAGAGATACA GTTACGATCTGCTGC TTTTTA Integrated DNA Technologies, (IDT) N/A (Continued on next page) Cell Reports 44, 115511, April 22, 2025 21 .. REAGENT or RESOURCE SOURCE IDENTIFIER N-WASP shRNA Rev: /5Phos/AGCTTAAAAAGCAGCAG ATCGTAACTGTATCTCTTGAATA CAGTTACGATCTGCTGC GGG Integrated DNA Technologies, (IDT) N/A See Table S1 for all other primers and oligonucleotides N/A Recombinant DNA ARHGAP12 Source BioScience IRATp970H02100D IMAGE clone ID #30528830 NCBI: BC094719 LifeAct-mCherry Addgene Cat# 193300 pEGFP C1 Addgene Cat# 13031 pmCherry C1 Clontech Cat# 632524 pET28b(+) Addgene Cat# 69865-3 pGEX6p1 Addgene Cat# 27-4597-01 pCS2-bNWASP Addgene Cat# 33019 TUBA (DNMBP) Addgene Cat# 91422 CIP4 (TRIP10) Addgene Cat# 91419 mCherry-ARHGAP12a This study N/A GFP-ARHGAP12a+b This study N/A GFP-SH3-tWW This study N/A GFP-SH3 This study N/A GFP- tWW This study N/A GST-SH3-tWW This study N/A GST-SH3 This study N/A GST-tWW This study N/A GST-NP1s This study N/A GST-NP1 This study N/A GST-NP2 This study N/A GST-NP3 This study N/A GST-NP4 This study N/A GST-NP5 This study N/A GST-NP6 This study N/A GST-NP7 This study N/A GST-NP8 This study N/A GST-NP3 PPAR This study N/A GST-NP3 PPSA This study N/A His6-ARHGAP12 SH3 This study N/A His6-CIP4 SH3 This study N/A His6-TUBA SH3 This study N/A His6-tWW This study N/A His6-tWW (WW2-R127A) This study N/A His6-tWW (WW2-S138A) This study N/A His6-tWW (WW2-W140A) This study N/A His6-tWW (WW2-Y129A) This study N/A His6-tWW (WW1-W82A) This study N/A GST-N-WASP-PRD This study N/A GFP-N-WASP This study N/A Software and algorithms ImageJ NIH Image https://imagej.net/ij/ Adobe Indesign Adobe https://www.adobe.com/sg/products/ indesign.html (Continued on next page) 22 Cell Reports 44, 115511, April 22, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Other Transwell filter inserts (6.5 mm) Corning Cat# 3413 Transwell filter inserts (12 mm) Corning Cat# 3401 Glass coverslips (12 mm, #1.5) Electron Microscopy Sciences Cat# 72230 Glutathione Sepharose 4B GST-tagged protein purification resin Cytiva Cat# 17075601 Ni-NTA Agarose Invitrogen Cat# R90115 HisTrap HP His tag protein purification columns Cytiva Cat# 17524801 HiLoad Superdex 200 pg preparative SEC columns (120mL) Cytiva Cat# 28989335

    Recombinant:

    Article Title: ARHGAP12 suppresses F-actin assembly to control epithelial tight junction mechanics and paracellular leak pathway permeability.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Osmium Tetroxide (2%) Electron Microscopy Sciences Cat# 19152 Potassium Ferricyanide Sigma-Aldrich Cat# 702587 Low Molecular Weight Tannic Acid Electron Microscopy Sciences Cat# 21700 Uranyl Acetate Electron Microscopy Sciences Cat# 22400 Lead Citrate Trihydrate Electron Microscopy Sciences Cat# 17800 Synthesized peptide NP1: RRQAPPPPPPSRGGP GenScript N/A Synthesized peptide NP1/2: RRQAPPPPPPSR GGPPPPPPPPHNSGPPPPPARGRGA GenScript N/A Synthesized peptide NP1/2/3: RRQAPPPPPPSRGGPPPPPPPPHN SGPPPPPARGRGAPPPPPSRAPTA GenScript N/A Synthesized peptide NP3/4/5: GRGAPPPPPSRAPTAAPPPPPP SRPSVAVPPPPPNRMYPPPPPALPSS GenScript N/A Synthesized peptide NP1 (R/A) mutant: RRQAPPPPPPSAGGP GenScript N/A Synthesized Mena peptide: GPPPPPPLPSTGPPP GenScript N/A Blebbistatin Sigma-Aldrich Cat# 203391 CK-666 MedChemExpress Cat# HY-16926 CK-869 MedChemExpress Cat# HY-16927 SMIFH2 MedChemExpress Cat# 340316-62-3 DMEM, high glucose Gibco Cat# 21068028 DMEM, high glucose, no glutamine, no calcium Gibco Cat# 21068028 Fluorescein sodium salt Sigma-Aldrich Cat# F6377 Fluorescein isothiocyanate–dextran (average mol wt 4,000) Sigma-Aldrich Cat# 46944 Fluorescein isothiocyanate–dextran (average mol wt 10,000) Sigma-Aldrich Cat# FD10S Fluorescein isothiocyanate–dextran (average mol wt 70,000) Sigma-Aldrich Cat# 46945 GFP-Trap Agarose Beads Chromotek Cat# gta-20 Paraformaldehyde Sigma-Aldrich Cat# 158127 PierceTM Protease Inhibitor Tablets, EDTA-free Thermo Fisher Scientific Cat# A32965 Polyethylenimine, Linear, MW 25000, Transfection Grade‘ Polysciences Cat# 23966-2 VECTASHIELD Antifade Mounting Medium Vector Laboratories Cat# H-1000-10 DAPI Sigma-Aldrich Cat# D9542 Phalloidin–Atto 565 Sigma-Aldrich Cat# 94072 Experimental models: Cell lines MDCK-II cells ATCC CCLV Cat# CCLV-RIE 1061; RRID: CVCL_0424 MDCK-II ARHGAP12 KO cells This study N/A MDCK-II ZO-1 KO cells Provided by Walter Hunziker N/A MDCK-II ZO-2 KO cells Provided by Walter Hunziker N/A HEK293T cells ATCC RRID: CVCL_0063 COS7 cells ATCC CLS Cat# 605470; RRID: CVCL_0224 Oligonucleotides ARHGAP12 gRNA For: CACCGTCTCATGCCGCCTGTTAAAC Integrated DNA Technologies, (IDT) N/A ARHGAP12 gRNA Rev: AAACGTTTAACAGGCGGCATGAGAC Integrated DNA Technologies, (IDT) N/A N-WASP shRNA For: /5Phos/GATCCCCGCAGCAGATC GTAACTGTATTCAAGAGATACA GTTACGATCTGCTGC TTTTTA Integrated DNA Technologies, (IDT) N/A (Continued on next page) Cell Reports 44, 115511, April 22, 2025 21 .. REAGENT or RESOURCE SOURCE IDENTIFIER N-WASP shRNA Rev: /5Phos/AGCTTAAAAAGCAGCAG ATCGTAACTGTATCTCTTGAATA CAGTTACGATCTGCTGC GGG Integrated DNA Technologies, (IDT) N/A See Table S1 for all other primers and oligonucleotides N/A Recombinant DNA ARHGAP12 Source BioScience IRATp970H02100D IMAGE clone ID #30528830 NCBI: BC094719 LifeAct-mCherry Addgene Cat# 193300 pEGFP C1 Addgene Cat# 13031 pmCherry C1 Clontech Cat# 632524 pET28b(+) Addgene Cat# 69865-3 pGEX6p1 Addgene Cat# 27-4597-01 pCS2-bNWASP Addgene Cat# 33019 TUBA (DNMBP) Addgene Cat# 91422 CIP4 (TRIP10) Addgene Cat# 91419 mCherry-ARHGAP12a This study N/A GFP-ARHGAP12a+b This study N/A GFP-SH3-tWW This study N/A GFP-SH3 This study N/A GFP- tWW This study N/A GST-SH3-tWW This study N/A GST-SH3 This study N/A GST-tWW This study N/A GST-NP1s This study N/A GST-NP1 This study N/A GST-NP2 This study N/A GST-NP3 This study N/A GST-NP4 This study N/A GST-NP5 This study N/A GST-NP6 This study N/A GST-NP7 This study N/A GST-NP8 This study N/A GST-NP3 PPAR This study N/A GST-NP3 PPSA This study N/A His6-ARHGAP12 SH3 This study N/A His6-CIP4 SH3 This study N/A His6-TUBA SH3 This study N/A His6-tWW This study N/A His6-tWW (WW2-R127A) This study N/A His6-tWW (WW2-S138A) This study N/A His6-tWW (WW2-W140A) This study N/A His6-tWW (WW2-Y129A) This study N/A His6-tWW (WW1-W82A) This study N/A GST-N-WASP-PRD This study N/A GFP-N-WASP This study N/A Software and algorithms ImageJ NIH Image https://imagej.net/ij/ Adobe Indesign Adobe https://www.adobe.com/sg/products/ indesign.html (Continued on next page) 22 Cell Reports 44, 115511, April 22, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Other Transwell filter inserts (6.5 mm) Corning Cat# 3413 Transwell filter inserts (12 mm) Corning Cat# 3401 Glass coverslips (12 mm, #1.5) Electron Microscopy Sciences Cat# 72230 Glutathione Sepharose 4B GST-tagged protein purification resin Cytiva Cat# 17075601 Ni-NTA Agarose Invitrogen Cat# R90115 HisTrap HP His tag protein purification columns Cytiva Cat# 17524801 HiLoad Superdex 200 pg preparative SEC columns (120mL) Cytiva Cat# 28989335

    Software:

    Article Title: ARHGAP12 suppresses F-actin assembly to control epithelial tight junction mechanics and paracellular leak pathway permeability.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Osmium Tetroxide (2%) Electron Microscopy Sciences Cat# 19152 Potassium Ferricyanide Sigma-Aldrich Cat# 702587 Low Molecular Weight Tannic Acid Electron Microscopy Sciences Cat# 21700 Uranyl Acetate Electron Microscopy Sciences Cat# 22400 Lead Citrate Trihydrate Electron Microscopy Sciences Cat# 17800 Synthesized peptide NP1: RRQAPPPPPPSRGGP GenScript N/A Synthesized peptide NP1/2: RRQAPPPPPPSR GGPPPPPPPPHNSGPPPPPARGRGA GenScript N/A Synthesized peptide NP1/2/3: RRQAPPPPPPSRGGPPPPPPPPHN SGPPPPPARGRGAPPPPPSRAPTA GenScript N/A Synthesized peptide NP3/4/5: GRGAPPPPPSRAPTAAPPPPPP SRPSVAVPPPPPNRMYPPPPPALPSS GenScript N/A Synthesized peptide NP1 (R/A) mutant: RRQAPPPPPPSAGGP GenScript N/A Synthesized Mena peptide: GPPPPPPLPSTGPPP GenScript N/A Blebbistatin Sigma-Aldrich Cat# 203391 CK-666 MedChemExpress Cat# HY-16926 CK-869 MedChemExpress Cat# HY-16927 SMIFH2 MedChemExpress Cat# 340316-62-3 DMEM, high glucose Gibco Cat# 21068028 DMEM, high glucose, no glutamine, no calcium Gibco Cat# 21068028 Fluorescein sodium salt Sigma-Aldrich Cat# F6377 Fluorescein isothiocyanate–dextran (average mol wt 4,000) Sigma-Aldrich Cat# 46944 Fluorescein isothiocyanate–dextran (average mol wt 10,000) Sigma-Aldrich Cat# FD10S Fluorescein isothiocyanate–dextran (average mol wt 70,000) Sigma-Aldrich Cat# 46945 GFP-Trap Agarose Beads Chromotek Cat# gta-20 Paraformaldehyde Sigma-Aldrich Cat# 158127 PierceTM Protease Inhibitor Tablets, EDTA-free Thermo Fisher Scientific Cat# A32965 Polyethylenimine, Linear, MW 25000, Transfection Grade‘ Polysciences Cat# 23966-2 VECTASHIELD Antifade Mounting Medium Vector Laboratories Cat# H-1000-10 DAPI Sigma-Aldrich Cat# D9542 Phalloidin–Atto 565 Sigma-Aldrich Cat# 94072 Experimental models: Cell lines MDCK-II cells ATCC CCLV Cat# CCLV-RIE 1061; RRID: CVCL_0424 MDCK-II ARHGAP12 KO cells This study N/A MDCK-II ZO-1 KO cells Provided by Walter Hunziker N/A MDCK-II ZO-2 KO cells Provided by Walter Hunziker N/A HEK293T cells ATCC RRID: CVCL_0063 COS7 cells ATCC CLS Cat# 605470; RRID: CVCL_0224 Oligonucleotides ARHGAP12 gRNA For: CACCGTCTCATGCCGCCTGTTAAAC Integrated DNA Technologies, (IDT) N/A ARHGAP12 gRNA Rev: AAACGTTTAACAGGCGGCATGAGAC Integrated DNA Technologies, (IDT) N/A N-WASP shRNA For: /5Phos/GATCCCCGCAGCAGATC GTAACTGTATTCAAGAGATACA GTTACGATCTGCTGC TTTTTA Integrated DNA Technologies, (IDT) N/A (Continued on next page) Cell Reports 44, 115511, April 22, 2025 21 .. REAGENT or RESOURCE SOURCE IDENTIFIER N-WASP shRNA Rev: /5Phos/AGCTTAAAAAGCAGCAG ATCGTAACTGTATCTCTTGAATA CAGTTACGATCTGCTGC GGG Integrated DNA Technologies, (IDT) N/A See Table S1 for all other primers and oligonucleotides N/A Recombinant DNA ARHGAP12 Source BioScience IRATp970H02100D IMAGE clone ID #30528830 NCBI: BC094719 LifeAct-mCherry Addgene Cat# 193300 pEGFP C1 Addgene Cat# 13031 pmCherry C1 Clontech Cat# 632524 pET28b(+) Addgene Cat# 69865-3 pGEX6p1 Addgene Cat# 27-4597-01 pCS2-bNWASP Addgene Cat# 33019 TUBA (DNMBP) Addgene Cat# 91422 CIP4 (TRIP10) Addgene Cat# 91419 mCherry-ARHGAP12a This study N/A GFP-ARHGAP12a+b This study N/A GFP-SH3-tWW This study N/A GFP-SH3 This study N/A GFP- tWW This study N/A GST-SH3-tWW This study N/A GST-SH3 This study N/A GST-tWW This study N/A GST-NP1s This study N/A GST-NP1 This study N/A GST-NP2 This study N/A GST-NP3 This study N/A GST-NP4 This study N/A GST-NP5 This study N/A GST-NP6 This study N/A GST-NP7 This study N/A GST-NP8 This study N/A GST-NP3 PPAR This study N/A GST-NP3 PPSA This study N/A His6-ARHGAP12 SH3 This study N/A His6-CIP4 SH3 This study N/A His6-TUBA SH3 This study N/A His6-tWW This study N/A His6-tWW (WW2-R127A) This study N/A His6-tWW (WW2-S138A) This study N/A His6-tWW (WW2-W140A) This study N/A His6-tWW (WW2-Y129A) This study N/A His6-tWW (WW1-W82A) This study N/A GST-N-WASP-PRD This study N/A GFP-N-WASP This study N/A Software and algorithms ImageJ NIH Image https://imagej.net/ij/ Adobe Indesign Adobe https://www.adobe.com/sg/products/ indesign.html (Continued on next page) 22 Cell Reports 44, 115511, April 22, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Other Transwell filter inserts (6.5 mm) Corning Cat# 3413 Transwell filter inserts (12 mm) Corning Cat# 3401 Glass coverslips (12 mm, #1.5) Electron Microscopy Sciences Cat# 72230 Glutathione Sepharose 4B GST-tagged protein purification resin Cytiva Cat# 17075601 Ni-NTA Agarose Invitrogen Cat# R90115 HisTrap HP His tag protein purification columns Cytiva Cat# 17524801 HiLoad Superdex 200 pg preparative SEC columns (120mL) Cytiva Cat# 28989335



    Similar Products

    93
    Addgene inc pet23a ubc9 addgene
    Pet23a Ubc9 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pet28b+addgene/pET28b-hUba2-His+(Plasmid+%2353117)/10__1038_slash_s44318___025___00532___y-257-18-19
    Average 93 stars, based on 1 article reviews
    pet23a ubc9 addgene - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    93
    Addgene inc pet28b his sae2 addgene
    Pet28b His Sae2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pet28b+addgene/pET28a-His-hAos1+(Plasmid+%2353135)/10__1038_slash_s44318___025___00532___y-257-11-12
    Average 93 stars, based on 1 article reviews
    pet28b his sae2 addgene - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    93
    Addgene inc gfp msfgfp addgene 48287 pam095 pet28b vector encoding iptg
    Gfp Msfgfp Addgene 48287 Pam095 Pet28b Vector Encoding Iptg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pet28b+addgene/pET+His6+msfGFP+TEV+cloning+vector+with+BioBrick+polycistronic+restriction+sites+(9GFP)+(Plasmid+%2348287)/pmc11573504__pnas__2413673121__sapp-49-47-49
    Average 93 stars, based on 1 article reviews
    gfp msfgfp addgene 48287 pam095 pet28b vector encoding iptg - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    93
    Addgene inc pet28b addgene
    Pet28b Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pet28b+addgene/pMPO+54+(Plasmid+%2369865)/pm40198220-297-53-54
    Average 93 stars, based on 1 article reviews
    pet28b addgene - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    93
    Addgene inc frauke melchior rrid addgene 53117 p3991 pet ubch9 peter howley rrid addgene 8651 rfp sumo3 morris
    Frauke Melchior Rrid Addgene 53117 P3991 Pet Ubch9 Peter Howley Rrid Addgene 8651 Rfp Sumo3 Morris, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pet28b+addgene/pET28b-hUba2-His+(Plasmid+%2353117)/pm40054443-345-10-8
    Average 93 stars, based on 1 article reviews
    frauke melchior rrid addgene 53117 p3991 pet ubch9 peter howley rrid addgene 8651 rfp sumo3 morris - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    93
    Addgene inc resource source identifier pet28a his haos1 frauke melchior rrid addgene 53135 pet28b huba2
    Resource Source Identifier Pet28a His Haos1 Frauke Melchior Rrid Addgene 53135 Pet28b Huba2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pet28b+addgene/pET28a-His-hAos1+(Plasmid+%2353135)/pm40054443-345-2-8
    Average 93 stars, based on 1 article reviews
    resource source identifier pet28a his haos1 frauke melchior rrid addgene 53135 pet28b huba2 - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    85
    Addgene inc ampr addgene pksj409 derivative
    Ampr Addgene Pksj409 Derivative, supplied by Addgene inc, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pet28b+addgene/pET28b(%2B)-TM0848+(Plasmid+%2367287)/pmc11867202__NIHMS2048962___supplement___Supporting_Information-648-69-70
    Average 85 stars, based on 1 article reviews
    ampr addgene pksj409 derivative - by Bioz Stars, 2026-10
    85/100 stars
      Buy from Supplier

    92
    Addgene inc pet28b gfp tglg addgene
    Pet28b Gfp Tglg Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pet28b+addgene/pET28b-GFP-tglG+(Plasmid+%23134679)/pm39321805-200-40-41
    Average 92 stars, based on 1 article reviews
    pet28b gfp tglg addgene - by Bioz Stars, 2026-10
    92/100 stars
      Buy from Supplier

    94
    Addgene inc paper n a pet28b his mouseube1 addgene
    Paper N A Pet28b His Mouseube1 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pet28b+addgene/pET28-mE1+(Plasmid+%2332534)/pm36398858-380-245-249
    Average 94 stars, based on 1 article reviews
    paper n a pet28b his mouseube1 addgene - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    93
    Addgene inc expression vector recombinant dna reagent pet28b gen9 addgene cat
    Expression Vector Recombinant Dna Reagent Pet28b Gen9 Addgene Cat, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pet28b+addgene/pIC247+(Plasmid+%2369741)/10__7554_slash_elife__57659-228-156-163
    Average 93 stars, based on 1 article reviews
    expression vector recombinant dna reagent pet28b gen9 addgene cat - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    Image Search Results